Skip to content
Open
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
Original file line number Diff line number Diff line change
Expand Up @@ -256,4 +256,9 @@

---

### Data analysis
### Data analysis

<img src="/images/materials/bioinformatics/3.svg" width="400">

Copy link
Copy Markdown
Collaborator

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

This image is not really true. Most of the time we do not have the reference genome of the bacteria, so we look for the closest relatives. And we do not really care where it maps on the reference.
What we are more interesting is to identify a taxonomic assignation for the reads

Copy link
Copy Markdown
Contributor Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

check

<img src="/images/protocols/beer-data-analysis/krona.png" width="400">

---
33 changes: 33 additions & 0 deletions _materials/2_nanopore_sequencing.html
Original file line number Diff line number Diff line change
@@ -0,0 +1,33 @@
---
layout: slides
title: "What is Nanopore Sequencing?"
---

![](/images/materials/introduction/protocol_sequencing.png)

---

### How to Read DNA


![](/images/materials/nanopore/1.svg)

---

### How to Read DNA


<iframe src="https://player.vimeo.com/video/337258910" width="640" height="360" frameborder="0" allow="autoplay; fullscreen" allowfullscreen></iframe>
<p><a href="https://vimeo.com/337258910">Animation: Nanopore sequencing</a> from <a href="https://vimeo.com/user5318092">Oxford Nanopore</a> on <a href="https://vimeo.com">Vimeo</a>.</p>

---

### Ingredients


- **Fragmentation Mix (FRA):** to cut DNA into shorter pieces.
- **Rapid Sequencing Adapter (RAP):** to allow the DNA to dock to the nanopore.
- **Flush Tether (FLT):** to guide the motorprotein to the pores.
- **Seqeuncing Buffer (SQB):** to create our ionic current.
- **Flush Buffer (FB):** to wash.
- **Loading Beads (LB):** to suck the DNA from the loading port into the flowcell.
107 changes: 107 additions & 0 deletions _materials/3_bioinformatics.html
Original file line number Diff line number Diff line change
@@ -0,0 +1,107 @@
---
layout: slides
title: "What is Bioinformatics?"
---

### Discuss: Where can you find Bioinformatics?

![](/images/materials/bioinformatics/1.svg)

---

### Where can you find Bioinformatics?

Chemistry, Biology, Physics: Creating Software for Devices

<img src="/images/materials/introduction/evolution_seq_technologies.svg" width="400">
<img src="/images/materials/bioinformatics/Blood_Glucose_Testing.jpeg" width="200">

---

### Where can you find Bioinformatics?

Chemistry, Biology, Physics: Analysis of Sequence Data

![](/images/materials/introduction/evolution_seq_technologies.svg)

---

### Where can you find Bioinformatics?

Chemistry, Biology, Physics: Analysis of Image Data

<img src="/images/materials/bioinformatics/cell_image.jpg" width="400">

---

### Where can you find Bioinformatics?

Mathematics, Statistics: Computer Science, Algorithms

<img src="/images/materials/bioinformatics/AI.png" width="400">

---


### Bioinformatics is the Bridge


![](/images/materials/bioinformatics/2.svg)

Copy link
Copy Markdown
Collaborator

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

I would put also Mathematics/Statistics with Computer Science

Copy link
Copy Markdown
Contributor Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Check


---

### Discuss: What kind of data will we encounter?

---

### Types of Data We Will Have

- **Raw Signal** (e.g., current/time-data of MinION)
- **Sequence Data** (e.g., FASTQ data)
- **Interpreted Data** (i.e., results of Kraken)

---

### Raw Signal Data

![](/images/materials/nanopore/1.svg)


---


### Sequence Data: FASTQ Format

```
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
```

- **Line 1:** Read ID
- **Line 2:** Sequence
- **Line 3:** Additional Information
- **Line 4:** Quality String

---

### Interpreted Data: Kraken

![](/images/materials/bioinformatics/3.svg)

Copy link
Copy Markdown
Collaborator

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Maybe better here to show the output table of Kraken, like

Taxon Read number
d__Eukaryota 2053
d__Eukaryota,k__Fungi 2053
d__Eukaryota|k__Fungi|p__Ascomycota 2049
d__Eukaryota|k__Fungi|p__Ascomycota|c__Saccharomycetes 2039
d__Eukaryota|k__Fungi|p__Ascomycota|c__Saccharomycetes|o__Saccharomycetales 2039
d__Eukaryota|k__Fungi|p__Ascomycota|c__Saccharomycetes|o__Saccharomycetales|f__Saccharomycetaceae 2026
d__Eukaryota|k__Fungi|p__Ascomycota|c__Saccharomycetes|o__Saccharomycetales|f__Saccharomycetaceae|g__Saccharomyces 1916
d__Eukaryota|k__Fungi|p__Ascomycota|c__Saccharomycetes|o__Saccharomycetales|f__Saccharomycetaceae|g__Saccharomyces|s__Saccharomyces cerevisiae 1807

And after a slide with the Krona chart.

What do you think?

Copy link
Copy Markdown
Contributor Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

check


---

### Interpreted Data: Kraken

<img src="/images/protocols/beer-data-analysis/krona.png" width="400">

---

### Interpreted Data: Kraken

|Taxon | Read number |
|-------|-------------|
| d__Eukaryota | 2053 |
| d__Eukaryota,k__Fungi | 2053 |
|d__Eukaryota,k__Fungi,p__Ascomycota | 2049 |
54 changes: 54 additions & 0 deletions _materials/4_nanopore_sequencing_extended.html
Original file line number Diff line number Diff line change
@@ -0,0 +1,54 @@
---

Copy link
Copy Markdown
Collaborator

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

As the content here is mostly text, not slides, we could maybe move it to the Sequencing protocol as a comment for the teachers

layout: slides
title: "Further Information about Nanopore Sequencing"
---

### Ingredients


- **Fragmentation Mix (FRA):** Ligases (Exonucleases) to cut DNA into shorter pieces. Will cut at certain sequences.
- **Rapid Sequencing Adapter (RAP):** Ligation of adapters to the DNA fragments (leader and hairpin adapter). The leader adapter will allow the DNA to dock to the nanopore. The hairpin adapter is then for the complement strand.
- **Flush Tether (FLT):** Guides the motorprotein to the pores.
- **Seqeuncing Buffer (SQB):** For the ionic current.
- **Flush Buffer (FB):** For washing.
- **Loading Beads (LB):** To increase the molecular weight of the DNA. Helps to suck the DNA from the loading port into the flowcell.

---

### Technical Remarks


- Double strands are required for nanopore-sequencing, because single strands would stop at the point where you have your adapter (ds position).
- The nanopore itself is strong enough to open up the ds. A helicase is not necessary.
- The MinION has 4 pores for 512 channels (in total 2048 pores).
- During the sequencing the MinION uses only one pore per channel. Every hour the lane will be checked and perhaps the MinION swaps to a different pore.
- The quality of the reads not decreases at the end of a read like in Illumina Sequencing.
- Average length 2-10 kb reads. Error Rate <10%, ~5-6% (which comes mostly from the basecalling).
- Change between template and complement strand is recognized by a specific signal of a site located in the hairpin adapter.
- [Literature](https://www.researchgate.net/publication/317848322_Nanopore_sequencing_data_analysis_state_of_the_art_applications_and_challenges)

---

### Base Calling


- Decoding the raw current signal into a base.
- Long stretches of the same base might induce a higher error (e.g., Poly-A-Tail problem).

---

### RNA Sequencing


- RNA sequencing is possible but so far you need to do a RNA PCR into ds strands (see technical remarks).
- Also possible is the standard way of a reverse trascription into cDNA and then a cDNA PCR.

---

### Max Scan


- It is the name for Nanopore's Current Checking.
- It will automatically determine which pores has the best electric field.
- Then the MinION will pick those pores for seqeuncing.
- This feature is important, since the quality can change over time for the base calling of the each pore.
Loading